Skip to main content

Advertisement

Table 1 Primer sequences for genotyping of embryonic and adult mice and sex-determination of embryonic mice

From: Spatiotemporal development of spinal neuronal and glial populations in the Ts65Dn mouse model of Down syndrome

 Target sequenceInternal control sequence
Ts65Dn (PCR)Chr17fwd: GTGGCAAGAGACTCAAATTCAACIMR8545: AAAGTCGCTCTGAGTTGTTAT
Chr16rev: TGGCTTATTATTATCAGGGCATTTIMR8546: GGAGCGGGAGAAATGGATATG
Ts65Dn (qPCR)Appfwd: TGCTGAAGATGTGGGTTCGAApobfwd: CACGTGGGCTCCAGCATT
Apprev: GACAATCACGGTTGCTATGACAAApobrev: TCACCAGTCATTTCTGCCTTTG
AppProbe:
FAM- CAAAGGCGCCATCATCGGACTCA-TAMRA
ApobProbe:
VIC- CCAATGGTCGGGCACTGCTCAA-TAMRA
Sex determinationSRY-fwd: GCTGGGATGCAGGTGGAAAAIMR8545: AAAGTCGCTCTGAGTTGTTAT
SRY-rev:
TGATGGCATGTGGGTTCCTG
IMR8546:
GGAGCGGGAGAAATGGATATG